Skip to main content

Table 1 Sequences of primers used for qRT-PCR

From: Release of extracellular vesicles containing small RNAs from the eggs of Schistosoma japonicum

Gene Name Sequence (5′–3′)
sja-miR-71b RT stem-loop primer CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGTCTCA
  Forward primer ACACTCCAGCTGGGTGAAAGACTTGAGT
sja-bantam RT stem-loop primer CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCAGCT
  Forward primer ACACTCCAGCTGGGTGAGATCGCGATTA
cel-miR-39 RT stem-loop primer CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAAGCTG
  Forward primer ACACTCCAGCTGGGTGTCACCGGGTGTAAAT
  Common reverse primer CTGGTGTCGTGGAGTCGGCAA
mmu-U6 Forward primer GCTTCGGCAGCACATATACTAAAAT
  Reverse primer CGCTTCACGAATTTGCGTGTCAT