Skip to main content

Advertisement

Table 1 PCR protocols used for Leishmania detection in dog samples

From: Evaluation of four molecular methods to detect Leishmania infection in dogs

Protocol Primer sequence Amplicon size (bp) PCR conditions (final concentration) Cycling conditions Reference
Nested SSU rRNA-PCR 1st PCR: R221: GGTTCCTTTCCTGATTTACG R332: GGCCGGTAAAGGCCGAATAG 603 10 μl DNA, 2 mM MgCl2, 0.2 mM dNTPs, 15 pmol primers, 1.4U Taq, 1× buffer (Promega) den.: 94 °C (30'); ann.: 60 °C (30'); ext.: 72 °C (30'); 35 cycles [34]
2nd PCR: R223: TCCATCGCAACCTCGGTT R333: AAAGCGGGCGCGGTGCTG 358 5 μl 1st PCR proda., 2 mM MgCl2, 0.2 mM dNTPs, 1.5 pmol primers, 0.7U Taq, 1× buffer (Promega) den.: 94 °C (30'); ann.: 65 °C (30'); ext.: 72 °C (30'); 32 cycles [10]
ITS1-PCR LITSR: CTGGATCATTTTCCGATG L5.8S: TGATACCACTTATCGCACTT 311 2 μl DNA, 1.5 mM MgCl2, 0.2 mM dNTPs, 25 pmol primers, 1U Taq, 1× buffer (Promega) den.: 95 °C (20'); ann.: 53 °C (20'); ext.: 72 °C (60'); 32 cycles [35]
MC-PCR MC1: GTTAGCCGATGGTGGTCTTG MC2: CACCCATTTTTCCGATTTTG 447 2 μl DNA, 3 mM MgCl2, 0.2 mM dNTPs, 15 pmol primers, 1U Taq, 1× buffer (Promega) den.: 94 °C (30'), ann.: 60 °C (30'); ext.: 72 °C (20'); 30 cycles [13]
Uni21/Lmj4-PCR Uni21: GGGGTTGGTGTAAAATAGGCC Lmj4b: CTAGTTTCCCGCCTCCGAG 800 2 μl DNA, 1.5 mM MgCl2, 25 pmol primers, 12,5 μl Biomix (Bioline) den.: 94 °C (30), ann.: 62 °C (30'); ext.: 72 °C (45'); 35 cycles [36]
  1. Abbreviations: bp base pairs, den. denaturation, ann. annealing, ext. extension, prod. product, PCR polymerase chain reaction, MC minicircle, ITS1 internal transcribed spacer 1, rRNA ribosomal RNA gene, SSU small subunit
  2. aPCR product was previously diluted 1:200 in ultra-pure water
  3. bUni21 primer based on a conserved region of a Leishmania major kinetoplastid minicircle sequence, and Lmj4 based on the variable region of the same L. major sequence