Skip to main content

Table 1 Primers and protocols used for the amplification of Cytauxzoon sp., Hepatozoon spp. and housekeeping GAPDH gene control

From: Molecular detection of Hepatozoon spp. and Cytauxzoon sp. in domestic and stray cats from Madrid, Spain

  PCR primers (5′-3′) PCR conditions Product size (bp)
PCR-1 F: CCAGCAGCCGCGGTAATTC 94 °C, 3 min; 35 cycles [94 °C, 30 s, 64 °C, 45 s, 72 °C, 30 s]; 72 °C, 7 min 373
R: CTTTCGCAGTAGTTYGTCTTTAACAAATCT   
PCR-2 F: CCTGGTTGATCCTGCCAG 96 °C, 3 min; 40 cycles [96 °C, 1 min, 65 °C, 1 min, 72 °C, 2 min]; 72 °C, 1 min 1,675
R: CGACTTCTCCTTCCTTTAAG   
Housekeeping (GAPDH) F: CCTTCATTGACCTCAACTACAT 95 °C, 1 min; 45 cycles [94 °C, 4 s, 57 °C, 4 s, 72 °C, 3 s]; 72 °C, 1 min 282
R: CCAAAGTTGTCATGGATGACC