Skip to main content

Advertisement

Table 1 PCR targets and primers used in this study for detection of Babesia spp., Bartonella spp., Ehrlichia/Anaplasma spp., H. canis, hemotropic Mycoplasma spp. and Rickettsia spp.

From: Molecular detection of vector-borne pathogens in blood and splenic samples from dogs with splenic disease

Species Target gene Forward primer (5′–3′) Reverse primer (5′–3′) Final primer concentration (μM) Reference
Babesia spp. 18S rRNA GACGATCAGATACCGTCGTAGTCC CAGAACCCAAAGACTTTGATTTCTCTC 0.3 [62]
Bartonella spp. ITS1 AGATGATGATCCCAAGCCTTCTG CCTCCGACCTCACGCTTATCA 0.3 Modified from [63, 64]
Ehrlichia spp.; Anaplasma spp. 16S rRNA GCAAGCYTAACACATGCAAGTCG GGATTATACAGTATTACCCAYCATTTCTARTG 0.5 [65, 66]
H. canis 18S rRNA CTTACCGTGGCAGTGACGGT ATTGTTATTTCTTGTTACTACCTCTCTCAAAC 0.3 [66]
Hemotropic Mycoplasma spp. 16S rRNA ATGTTGCTTAATTCGATAATACACGAAA ACRGGATTACTAGTGATTCCAACTTCAA 0.3/0.5 [65]
Rickettsia spp. ITS2 GCTCGATTGRTTTACTTTGCTGTGAG CATGCTATAACCACCAAGCTAGCAATAC 0.5/0.3 [62]
  1. Abbreviations: rRNA ribosomal ribonucleic acid, ITS internal transcribed spacer