Skip to main content

Advertisement

Table 1 Primer sequences used in this study

From: Emergence of Babesia canis in southern England

Gene Gene Sequence (5'–3') Reference
Piroplasm 18S ribosomal RNA Piro A Piro B AATACCCAATCCTGACACAGGG TTAAATACGAATGCCCCCAAC [29]
Piroplasm cytochrome c oxidase 1 Bbmit2 Bbmit3 CGACTTCTCTATTGTCTC ATGTCGTCTCACCATACC This study
Tick cytochrome c oxidase 1 LCO1490 HCO2198 GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA [30]