Skip to main content

Table 1 Primer sequences used in this study

From: Emergence of Babesia canis in southern England

Gene Gene Sequence (5'–3') Reference
Piroplasm 18S ribosomal RNA Piro A
Piro B
AATACCCAATCCTGACACAGGG
TTAAATACGAATGCCCCCAAC
[29]
Piroplasm cytochrome c oxidase 1 Bbmit2
Bbmit3
CGACTTCTCTATTGTCTC
ATGTCGTCTCACCATACC
This study
Tick cytochrome c oxidase 1 LCO1490
HCO2198
GGTCAACAAATCATAAAGATATTGG
TAAACTTCAGGGTGACCAAAAAATCA
[30]