Skip to main content

Advertisement

Table 1 Primer sequences used in this study

From: NLRP3 inflammasome activation in murine macrophages caused by Neospora caninum infection

Gene Accession number Primer sequence (5'-3') Size (bp) Reference
Murine
NLRP3 NM_145827 Forward: AGAAGAGACCACGGCAGAAG 102 [23]
Reverse: CCTTGGACCAGGTTCAGTGT
NLRC4 NM_001033367.3 Forward: CTTGGCCAGGAGAGCCTTG 153  
Reverse: GGGCTCGTCTGTTGTTCCTT  
NLRC5 NM_001033207.3 Forward: GCTGAGAGCATCCGACTGAA 157  
Reverse: GGTGGATGACCTCAGGGTTG  
ACTB NM_007393.5 Forward: ACCTTCTACAATGAGCTGCG 147  
Reverse: CTGGATGGCTACGTACATGG  
Neospora caninum
NC5 X84238 Forward: ACTGGAGGCACGCTGAACAC 76 [25]
Reverse: AACAATGCTTCGCAAGAGGAA