Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used in the experiments

From: Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia

Name Sequence (5'–3')
IIP_F GGTGGAACTTCACCGACTTC
IIS6_R GGACGCAATCTGGCTTGTTA
F1534-f GCGGGCTCTACTTTGTGTTCTTCATCATATT
C1534-f GCGGGCAGGGCGGCGGGGGCGGGGCCTCTACTTTGTGTTCTTCATCATGTG
CP-r TCTGCTCGTTGAAGTTGTCGAT
Ge-IIIS6_F GCTGTCGCACGAGATCATT
IIIS6_R GTTGAACCCGATGAACAACA