Skip to main content

Table 1 Details of the primer sequences and combinations evaluated for the assay development

From: SYBR green-based one step quantitative real-time polymerase chain reaction assay for the detection of Zika virus in field-caught mosquitoes

Primer name Sequence (5′-3′) Genome positiona
Forward primers
 ZIKV-Fb TTGGTCATGATACTGCTGATTGC 941–963
 ZIKV-F2 TCAACGAGCCAAAAAGTCAT 917–936
 ZIKV-F3 ATCAGGTGCATAGGAGTCAG 977–996
Reverse primers
 ZIKV-Rb CCTTCCACAAAGTCCCTATTGC 996–1016
 ZIKV-R3 CAGGTCCCACCTGACATGC 1017–1035
 ZIKV-R4 CAACGACTGTCCGAAGCCATG 1177–1197
  1. aGenome positions were calculated from the first base of the 5′ non-translated region of the ZIKV reference sequence in GenBank nucleotide database (Accession no. NC012532.1)
  2. bPrimers previously used for a probe-based rRT-PCR protocol published by Lanciotti et al. [9]