Skip to main content

Table 1 Primers for the control plasmid constructs of β-tubulin isotype 1 gene sequences

From: Isothermal diagnostic assays for the detection of soil-transmitted helminths based on the SmartAmp2 method

STH Primer sequence (5′–3′)
A. lumbricoides Forward: CACATACGGAGACCTCAACC
Reverse: CAGTAAGGTAACGACCGTGC
N. americanus Forward: CGAACCCAACATATGGAGATC
Reverse: CCATCATGTTCTTTGCGTCG
T. trichiura Forward: CAACACCAACTTACGGAGAC
Reverse: GTGACGAGGATCACAAGCAG