Skip to main content

Table 2 List of primers used for PCR amplifications and their sequences

From: Survey of Anaplasma phagocytophilum and Anaplasma sp. ‘Omatjenne’ infection in cattle in Africa with special reference to Ethiopia

Primer Sequence (5′-3′) Target gene Size (bp) Reference
HER 16SD GGTACCYACAGAAGAAGTCC 16S rDNA 925 [20]
EBR2 TGCTGACTTGACATCATCCC [16]
EBR3 TTGTAGTCGCCATTGTAGCAC [16]
AB128 ACTAGTAGAAATTGCACAATCTAT pCS20 280 [21]
AB129 TGATAACTTGGTGCGGGAAATCCTT [21]
ITM130 TCAATTGCTTAATGAAGCACTAACTCAC [21]