Skip to main content

Table 1 Primers and annealing temperature for the identification of G. duodenalis and E. bieuensi

From: First report of Giardia duodenalis and Enterocytozoon bieneusi in forest musk deer (Moschus berezovskii) in China

Gene locus Primer sequences (5’–3’) Annealing temperature (°C) Expected product size (bp) Reference
bg F1: AAGCCCGACGACCTCACCCGCAGTGC 50 511 [19]
R1: GAGGCCGCCCTGGATCTTCGAGACGAC    
F2: GAACGAACGAGATCGAGGTCCG 60   
R2: CTCGACGAGCTTCGTGTT    
gdh F1: TTCCGTRTYCAGTACAACTC 50 530 [19]
R1: ACCTCGTTCTGRGTGGCGCA    
F2: ATGACYGAGCTYCAGAGGCACGT 65   
R2: GTGGCGCARGGCATGATGCA    
tpi F1: AAATIATGCCTGCTCGTCG 55 530 [19]
R1: CAAACCTTITCCGCAAACC    
F2: CCCTTCATCGGIGGTAACTT 55   
R2: GTGGCCACCACICCCGTGCC    
ITS F1: GATGGTCATAGGGATGAAGAGCTT 55 392 [20]
R1: AATACAGGATCACTTGGATCCGT    
F2: AGGGATGAAGAGCTTCGGCTCTG 55   
R2: AATATCCCTAATACAGGATCACT    
MS1 F1: CAAGTTGCAAGTTCAGTGTTTGAA 58 676 [21]
R1: GATGAATATGCATCCATTGATGTT    
F2: TTGTAAATCGACCAAATGTGCTAT 58   
R2: GGACATAAACCACTAATTAATGTAAC    
MS3 F1: CAAGCACTGTGGTTACTGTT 55 537 [21]
R1: AAGTTA GGGCATTTAATAAAATTA    
F2: GTTCAAGTAATTGATACCAGTCT 55   
R2: CTCATTGAATCTAAATGTGTATAA    
MS4 F1: GCATATCGTCTCATAGGAACA 55 885 [21]
R1: GTTCATGGTTATTAATTCCAGAA    
F2: CGAAGTGTACTACATGTCTCT 55   
R2: GGACTTTAATAAGTTACCTATAGT    
MS7 F1: GTTGATCGTCCAGATGGAATT 55 471 [21]
R1: GACTATCAGTATTACTGATTATAT    
F2: CAATAGTAAAGGAAGATGGTCA 55   
R2: CGTCGCTTTGTTTCATAATCTT