Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers for amplification of seven overlapping DNA fragments and their positions in the mtDNA of Echinococcus (G10) isolate from Gansu, China, and four additional primer pairs used to amplify a region containing SNR. The positions of the primers are based on the mt genome sequence of E. canadensis (G10; AB745463)

From: Mitochondrial genome data confirm that yaks can serve as the intermediate host of Echinococcus canadensis (G10) on the Tibetan Plateau

Primer name Primer sequence (5′ → 3′) Positions on the H-strand Size of PCR product (bp)
F1 TTTGTAAAGATGCCAGAAAA 244–266 2110
R1 AYCTAGATCATTTTTTTGGA 2337–2356
F2 GCCCCATATATGTATAGTAT 2225–2244 1962
R2 TATACACCGAAGAATAGCAT 3897–3916
F3 GATTTRGTGTATTTTCATTCRTA 3710–3732 2508
R3 CCAAAACACCCTAACCTAATAT 6196–6217
F4 ATCGTTTGCCWTATTGTTATAG 5965–5986 2622
R4 TAACGGAAAATAAATTCACA 8567–8586
F5 TGCTGTTAACTTCAAGAAATGG 8418–8439 1885
R5 ACATAACATAATGAAAATGAGC 10,281–10,302
F6 ATATGTTTACTGTTGGGTTRGAT 10,027–10,049 2352
R6 GCAGCACATAGACTTGGCTT 12,360–12,379
F7 CATCTGCGGTTARTCTGTTTTC 12,036–12,057 2143
R7 TAATGCTTAAAACTAACTCATA 437–458
F8 TTTATTTTTGTGTCGGTGTTTG 13,448–13,469 1387
R8 CCCGCATAGCCTCCAACAA 1096–1114
F9 TTCTGGTGTTAAGTGTTGTG 13,659–13,678 498
R9 TAACTTCTGACATAGCTACC 417–436
F10 GGCTTGTGTGTATTATTTGG 13,514–13,533 793
R10 ACAAACCTATACTAACACAC 567–586
F11 GGTGTTAAGTGTTGTGGCCAGAAA 13,663–13,686 530
R11 GAAACATCCATAATTAATGCTTAAAACTAACTC 440–472
  1. Abbreviations: R, A/G; W, A/T; Y, T/C