Skip to main content

Table 2 Details of predicted novel miRNAs by the deep sequencing

From: Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches

Mature name Mature sequence Precursor name Precursor sequence Strand Precursor coordinate at genome
asi-miR-nov1 ugagaucaugacaguucaucg asi-mir-nov1 ggugaaaugcuguguucucauaguaaacuacuggcuucuaugagaucaugacaguucaucg + gi|527265913|23455–23516
asi-miR-nov2 uaguacggugcgacuccccgu asi-mir-nov2 cgggugagucuugccguacuacguguacuuuuguuauucucguaguacggugcgacuccccgu + gi|527266706|776475–776538
asi-miR-nov3 ugacuagauugcuuuggcuagu asi-mir-nov3 cagcgaaagugguuuaguuuagcgcgcuuauucgaauguguugacuagauugcuuuggcuagu + gi|527270116|1744899–1744962
asi-miR-nov4 auuagaauguggaaucuguuuuu asi-mir-nov4 auuagaauguggaaucuguuuuuguacguguuacagaaauaugcaaaaaaguuuucauauucuugcgg - gi|527266109|2021832–2021900
asi-miR-nov5 ucuaucauuugaguaccauga asi-mir-nov5 cgugguacucuuuugguacggaguuucaaguaaagaauaccaucucuaucauuugaguaccauga + gi|527269397|156302–156367
asi-miR-nov6 ucaugucgacgcauccucugauu asi-mir-nov6 aggaggauguguuggucaugaugguauuuuuucacaucaugucgacgcauccucugauu - gi|527231551|703–762
asi-miR-nov7 cggcccggaucguucgcaca asi-mir-nov7 cggcccggaucguucgcacacgccagagcgaacgcauacgggcugcc - gi|527266065|40908–40955
asi-miR-nov8 gauucccucccuacuggacguacc asi-mir-nov8 gauucccucccuacuggacguaccaaccguacagccggggucggggucuaauc - gi|527266109|1340028–1340081
asi-miR-nov9 gaggagcugcaggccgcc asi-mir-nov9 cgcccgucgcccuucgucagccgguacgacuucaauggcgccgagguggacgaggagcugcaggccgcc + gi|527269794|806826–806895
asi-miR-nov10 aacgagcgucccggaccgcc asi-mir-nov10 uggcccguaggugcuacguucguacgcguuacgaucgaacgagcgucccggaccgcc - gi|527266084|1600353–1600410
asi-miR-nov11 agcgggcucgagcggucacc asi-mir-nov11 gacuguuccacccuccgucacaccaaagcaagcgggcucgagcggucacc + gi|527266274|736982–737032
asi-miR-nov12 ugcauucaguggggcggucgc asi-mir-nov12 gauccuccuccguggauggcacguagucccaguugcuaaccggcgugcauucaguggggcggucgc - gi|527266901|716673–716739