Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for conventional PCR amplification of partial regions of gltA and ompB genes [12]

From: The epidemiology of Rickettsia felis infecting fleas of companion animals in eastern Australia

Primer Sequence (5'-3') Product size (bp)
ompB-F CGACGTTAACGGTTTCTCATTCT 252
ompB-R ACCGGTTTCTTTGTAGTTTTCGTC
gltA-F1 GCAAGTATTGGTGAGGATGTAATC 654
gltA-R1 CTGCGGCACGTGGGTCATAG
gltA-F2 GCGACATCGAGGATATGACAT
gltA-R2 GGAATATTCTCAGAACTACCG