Skip to main content

Advertisement

Table 1 Nucleotide sequences of primers and TaqMan MGB probes used in the duplex qPCR assay

From: Development and validation of a duplex real-time PCR assay for the diagnosis of equine piroplasmosis

Oligonucleotide name Nucleotide sequence (5'-3') and modifications Reference
TeEMA1-F CTGACTACAAGGTYGTATAC This study
TeEMA1-R TGTCGTCACTTAGTAAAATAGA This study
TeEMA1-P 6-FAM-TTCTCCGTCTATGGCGCA-MGB-NFQ This study
Bc_18SF402 GTAATTGGAATGATGGCGACTTAA Bhoora et al. [27]
Bc_18SR496 CGCTATTGGAGCTGGAATTACC Bhoora et al. [27]
Bc_18SP VIC-CCTCGCCAGAGTAA-MGB-NFQ Bhoora et al. [27]
  1. Abbreviations: Y, T or C; MGB, minor groove binder; NFQ, non-fluorescent quencher