Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Details of the qPCR/PCR assays used in the study for the detection of tick-borne pathogens

From: Anaplasma phagocytophilum, Bartonella spp., haemoplasma species and Hepatozoon spp. in ticks infesting cats: a large-scale survey

Target species (target gene) PCR primer and probe sequences (5'–3') Product size (bp) Reference
Anaplasma phagocytophilum (msp2) F: ATGGAAGGTAGTGTTGGTTATGGTATT 77 [7]
Bartonella henselae (alr-gcvP intergenic spacer) F: GAGGGAAATGACTCTCTCAGTAAAA 110 [9]a
Bartonella spp. (ssrA) F: GCTATGGTAATAAATGGACAATGAAATAA 299 [8]b
Candidatus Mycoplasma haemominutum” (16S rRNA gene) F: TGATCTATTGTKAAAGGCACTTGCT 135 [10]
Candidatus Mycoplasma turicensis” (16S rRNA gene) F: AGAGGCGAAGGCGAAAACT 138 [10]
Feline genomic DNA (28S rRNA) F: AGCAGGAGGTGTTGGAAGAG 100 [10]
Hepatozoon. spp. (18S rRNA gene) F: AAACGGCTACCACATNTAAGGA 522 [11]
Mycoplasma haemofelis (16S rRNA gene) F: GTGCTACAATGGCGAACACA 80 [10]
  1. aThe reverse and probe sequences in the original paper are incorrectly labelled; the correct sequences are cited in this table
  2. bThe reverse primer has been modified compared to the one described in the paper
  3. Abbreviations: F, forward primer sequence; R, reverse primer sequence; FAM, 6-carboxyfluorescein; BHQ, black hole quencher (1 or 2 as indicated)