Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for the subcloning and sequencing of recombinant plasmids

From: A novel Babesia orientalis 135-kilodalton spherical body protein like: identification of its secretion into cytoplasm of infected erythrocytes

Primer Primer sequence (5'-3') Restriction endonuclease
SBP3-like-F ATGAGGCGCTTCACCCTGCTAGCGTTG  
SBP3-like-R TTACATGTCCATACCGACGCGGCATAG  
SBP3-like-F1 CGGATCCATGAGGCGCTTCACCCTG BamHI
SBP3-like-R1 GCGTCGACAATCTGAGTGAAGTTGACG SalI
SBP3-like-F2 GGAATTCATGGCCCCACCTTCTGCC EcoRI
SBP3-like-R2 GCGTCGACTTACTGGAGGAAGAACTGG SalI
SBP3-like-F3 CGGATCCATGATCACTGCTTACGAC EcoRI
SBP3-like-R3 GCGTCGACTTACATGTCCATACCGACG Sal I