Skip to main content

Table 1 Primers for PCR amplification and qPCR reaction

From: Effects of antibiotic treatment on the fecundity of Rhipicephalus haemaphysaloides ticks

Organism Target gene Primer Sequence (5'-3') Reference
Bacteria 16S 338f ACTCCTRCGGGAGGCAGCAG [19]
806r GGACTACCVGGGTATCTAAT  
R. haemaphysaloides Actin gene Ractin-F GTGCCCATCTACGAAGGTTAC This study
Ractin-R CCATCTCCTGCTCGAAGTCC  
Rickettsia-like endosymbiont Citrate synthase gene (gltA) gltA-F TCCTACATGCCGACCATGAG [20]
gltA-R AAAGGGTTAGCTCCGGATGAG  
Coxiella-like endosymbiont 16S rRNA gene L-CoxF TGAGTGTTGACGTTACCCACAG This study
L-CoxR GCATTTCACCGCTACACCG