Skip to main content

Advertisement

Table 1 The oligonucleotides used in this study

From: Recombinase polymerase amplification assay combined with a lateral flow dipstick for rapid detection of Tetracapsuloides bryosalmonae, the causative agent of proliferative kidney disease in salmonids

Primer name Primer sequence (5'–3') Genome position Primer length (bp) GenBank ID Method Reference
PKD-RPA_F TAATACGGATGTGGGTTAGTGGAAACTGGG 48–77 30 JQ424926 RPA This study
PKD-RPA_R Digoxigenin-CGTGAATCAGACCAAATATCTTCAAGATGACAAG 155–188 34
PKD-RPA_P FAM-GGAGTGGGAAGATAATACGTAAACGTGCATTZGCCAAGTATTTAATAG-(C3spacer) 106–153 48
PKX 5 F CCTATTCAATTGAGTAGGAGA 463–483 21 U70623 PCR [36]
PKX 6 R GGACCTTACTCGTTTCCGACC 877–897 21