Skip to main content

Table 1 Sequences of primers used in this study

From: Identification of an interaction between calcium-dependent protein kinase 4 (EtCDPK4) and serine protease inhibitor (EtSerpin) in Eimeria tenella

Primer ID Primer sequence (5'-3')
pBiFC-VN155-Serpin UP ATGGCCATGGAGGCCCGAATTCGGGCCACCATGGCTCTGTTGAGTAAGCT
pBiFC-VN155-Serpin LOW ACGCCGGACGGGTACCTCGAGCTGCTGTGCTGCTGCCGG
pBiFC-VC155-CDPK4 UP GCGAATTCGGGCCACCATGGAGCAGGTGATGGGTGGGCGGGAGGT
pBiFC-VC155-CDPK4 LOW GCGGTACCAAATTCGTCCCAGTCAATCTGCCCAT
pCDNA3.1-flag-CDPK4 UP CGCGGATCCATGGAGCAGGTGATGGGTGGGCGGGAGGT
pcDNA3.1-flag-CDPK4 LOW GCGAATTCCTAAAATTCGTCCCAGTCAATCTGCCCAT