Skip to main content

Table 1 PCR primers used for Babesia spp., Rickettsia spp. and Anaplasma spp. and C. burnetii screening

From: Babesia vesperuginis in insectivorous bats from China

Target agent PCR method Primer Primer sequences (5'→3') Target gene Amplicon size (bp) Tissue tested Reference
Babesia spp. PCR BJ1 GTCTTGTAATTGGAATGATGG 18S rDNA ~500 Blood [10]
Nested PCR Bab_For1 ATWGGATTYTATATGAGTAT cox1 924 [7]
Rickettsia spp. qPCR gltA-F GTGAATGAAAGATTACACTATTTAT gltA Blood [30]
Anaplasma spp. Nested PCR AE1-F AAGCTTAACACATGCAAGTCGAA 16S rRNA 926 Blood [31]
Coxiella burnetii Nested PCR omp1 AGTAGAAGCATCCCAAGCATTG com1 438 Spleen [32]