Skip to main content

Advertisement

Table 1 PCR primers used for Babesia spp., Rickettsia spp. and Anaplasma spp. and C. burnetii screening

From: Babesia vesperuginis in insectivorous bats from China

Target agent PCR method Primer Primer sequences (5'→3') Target gene Amplicon size (bp) Tissue tested Reference
Babesia spp. PCR BJ1 GTCTTGTAATTGGAATGATGG 18S rDNA ~500 Blood [10]
BN2 TAGTTTATGGTTAGGACTACG
Nested PCR Bab_For1 ATWGGATTYTATATGAGTAT cox1 924 [7]
Bab_Rev1 ATAATCWGGWATYCTCCTTGG
Bab_For2 TCTCTWCATGGWTTAATTATGATAT
Bab_Rev2 TAGCTCCAATTGAHARWACAAAGTG
Rickettsia spp. qPCR gltA-F GTGAATGAAAGATTACACTATTTAT gltA Blood [30]
gltA-R GTATCTTAGCAATCATTCTAATAGC
qPCR 338-F GAMAAATGAATTATATACGCCGCAAA RC0338 gene
338-R ATTATTKCCAAATATTCGTCCTGTAC
Anaplasma spp. Nested PCR AE1-F AAGCTTAACACATGCAAGTCGAA 16S rRNA 926 Blood [31]
AE1-R AGTCACTGACCCAACCTTAAATG
EE3 GTCGAACGGATTATTCTTTATAGCTTGC
EE4 CCCTTCCGTTAAGAAGGATCTAATCTCC
Coxiella burnetii Nested PCR omp1 AGTAGAAGCATCCCAAGCATTG com1 438 Spleen [32]
omp2 TGCCTGCTAGCTGTAACGATTG
omp3 GAAGCGCAACAAGAAGAACA
omp4 TGGAAGTTATCACGCAGTTG