Skip to main content

Advertisement

Table 1 List of quantitative real-time PCR primers

From: Differential modulation of host immune genes in the kidney and cranium of the rainbow trout (Oncorhynchus mykiss) in response to Tetracapsuloides bryosalmonae and Myxobolus cerebralis co-infections

Primer name Primer sequence (5′-3′) Amplicon size (bp) GenBank ID Reference
T. bryosalmonae RPL18 F GTAAACGGGGACAAAAAGA 251 FR852769 [8]
T. bryosalmonae RPL18 R GGAGCAGCACCAAAATAC
Myx18-909 F CTTTGACTGAATGTTATTCAGTTACAGCA 88 AF115253 [39]
Myx18-996 R GCGGTCTGGGCAAATGC
SOCS-1 F GATTAATACCGCTGGGATTCTGTG 136 AM748721 [8]
SOCS-1 R CTCTCCCATCGCTACACAGTTCC
SOCS-3 F CACAGAGAAACCGTTAAAAGGACTATCC 228 AM748723 [8]
SOCS-3 R AAGGGGCTGCTGCTCATGAC
JAK-1 F ACACTGATATTGGGCCGTTCTGGA 174 CA378782 [40]
JAK-1 R CCTCGTCCTCTGCATCTTTACCAAC
STAT-3 F GAATGAAGGGTATATTCTGG 152 U60333 [41]
STAT-3 R TCCCACTGATGTCCTTTTCC
EF-1α F AGACAGCAAAAACGACCCCC 167 HF563594 [42]
EF-1α R AACGACGGTCGATCTTCTCC
  1. These primers were used in RT-qPCR to quantify the relative gene expression in posterior kidneys and cranial cartilages of infected rainbow trout during single and co-infections