Skip to main content

Table 2 Trichinella britovi microsatellite primer pairs

From: Multilocus genotype analysis outlines distinct histories for Trichinella britovi in the neighboring Mediterranean islands of Corsica and Sardinia

Code Length (bp) Primer pairs (5'-3')
Forward Reverse
TS1010B 240 CATTAACGATGTGCTATTTAACGCT CCAACAACATCCTCAACA
TS1380 285 TCAATTCATTTCATTTCAATCTGCG CACCTTACAATCAAGTAACC
TB1019 285 CGGACAGATTCAGCGGA AGCCAACTCAAGTCCCAAA
TB922 250 ATGGGCCAACAACTACCACTA AAACGGCAATGCAACAAC