Skip to main content

Table 1 Primer sets of B. bigemina homologs of P. falciparum gamete-specific genes

From: Identification of a putative methyltransferase gene of Babesia bigemina as a novel molecular biomarker uniquely expressed in parasite tick stages

Gene Forward primer (5'-3') Reverse primer (5'-3') Amplicon size (bp)
BBBOND_0204030 GAGGAAATCGATGGGACGTATG GGTACTCCATGTGACGTTTAGG 496
BBBOND_0204030 (nested PCR) ACATCTCTGCGTCTTGCATAA GGACTGTATGTATGCCCTTCAG 204
BBBOND_0310420 GAGCAGGTGGCGACATATT CCTTGATACCGTTTCCCATAGAG 330
BBBOND_0110620 GTCGAGAAAGGCCAGGATAAA TGTGTCATGGGAGGGTTTG 382
BBBOND_0308930 CGAGGGCGCTACTCTATTC CACTGATGTTTCGTGGCTTAC 267
BBBOND_0200260 ATGTCGAAGGATTCCACTGC CTTGCGAGAGGATGGTGTG 208
BBBOND_0311670 GAAGCCTGAGTGGAACCTAAA GCGGAGGTGGGATTCATATT 343
BBBOND_0208380 TCGTCGCGTGGAATTCATAG TGTTCACCGCCTCGAAATAG 449
BBBOND_0305250 GCGAGTACTGCGGCATTTA CTGAAGCCAAGCTGAGGTG 295
BBBOND_0307580 CGAAGATCCTCGTGCTGATAAT GAGCGGGTTGTATAGGTACTTG 386
BBBOND_0310760 TGCTTCACCTGCGGCAA TCAGATGTGCTCCTGGTTCC 204
BBBOND_0311270 ATCTGCAAGTTCTGGGAGAAG CATGTAGCCCTGCTGTTGATA 477
BBBOND_0203950 (CCp2) TCCACAACAAGCAACTCC GCTTTGTAGGTAGAGTCAGC 168
BBBOND_0312400 (CCp3) GAGTCCTCCGTGTAGATGAAC GAAGCTTACTTGCTACGACAAC 141
BBBOND_0307410 (HAP2) GCTGAAGACGAAGGTGAGGA GCGATGATCTGGGTGACG 164
BBBOND_0107357 (actin) ATCGCCGTTTACACTTCACG GCCCCTTCCTCCTCGTAATC 131