Skip to main content

Table 1 Primers and probes used in tick species determination and pathogen screening

From: Tick-borne pathogens in Finland: comparison of Ixodes ricinus and I. persulcatus in sympatric and parapatric areas

Primer/probe name Target Nucleotide sequence (5' → 3') Amplicon size (bp)a Reference
Real-time: PCR
 Bbsl-ospA-F B. burgdorferi ospA AATATTTATTGGGAATAGGTCTAA 59 [83]
 Bbsl-ospA-R CACCAGGCAAATCTACTGA
 Bbsl-ospA-P [6FAM]-TTAATAGCATGTAAGCAAAATGTTAGCA-[DDQ1]
 IXO-I2-F4 Ixodes spp. ITS2 TCTCGTGGCGTTGATTTGC 64 [27]
 IXO-I2-R4 Ixodes spp. ITS2 CTGACGGAAGGCTACGACG
 Ipe-I2-P4 I. persulcatus ITS2 [FAM]-TGCGTGGAAAGAAAACGAG-[BHQ1]
 Iri-I2-P4 I. ricinus ITS2 [VIC]-TGCTCGAAGGAGAGAACGA-[BHQ1]
 Rspp-F Rickettsia spp. gltA GAGAGAAAATTATATCCAAATGTTGAT 100 [84]
 Rspp-R AGGGTCTTCGTGCATTTCTT
 Rspp-P [Cy5]-CATTGTGCCATCCAGCCTACGGT-[BHQ3]
 Bab18S-F Babesia spp. 18S rRNA CAGCTTGACGGTAGGGTATTGG 20 [85]
 Bab18S-R TCGAACCCTAATTCCCCGTTA
 Bab18S-P [HEX]-CGAGGCAGCAACGG-[BHQ1]
 ApMSP2-F Anaplasma spp. Msp2 ATGGAAGGTAGTGTTGGTTATGGTATT 30 [86]
 ApMSP2-R TTGGTCTTGAAGCGCTCGTA
 ApMSP-P [CY5]-TGGTGCCAGGGTTGAGCTTGAGATTG-[BBQ650]
 CNeGroEL-F Ca. Neoehrlichia mikurensis” GroEL CCTTGAAAATATAGCAAGATCAGGTAG 47 [87]
 CNeGroEL-R CCACCACGTAACTTATTTAGCACTAAAG
 CNeGroEL-P [FAM]-CCTCTACTAATTATTGCWGAAGATGTAGAAGG TGAAGC-[BHQ1]
 BartssRA-F Bartonella spp. ssrA GCTATGGTAATAAATGGACAATGAAATAA 255 [88]
 BartssRA-R GCTTCTGTTGCCAGGTG
 BartssRA-P [FAM]-ACCCCGCTTAAACCTGCGACG-[BHQ1]
 Ftu23-F F. tularensis 23 Kda TGAGATGATAACAAGACAACAGGTAAC 30 [89]
 Ftu23-R GGATGAGATCCTATACATGCAGTAGGA
 Ftu23-P [FAM]-CCATTCATGTGAGAACTG-[BHQ1]
PCR
 B5Sborseq-F Borrelia IGS GAGTTCGCGGGAGAGTAGGTTATTGCC 367 [28]
 23Sborseq-R TCAGGGTACTTAGATGGTTCACTTCC
 CS877-F Rickettsia spp. gltA GGGGACCTGCTCACGGCGG 381 [90]
 CS1258-R ATTGCAAAAAGTACAGTGAACA
 Ana2-F Anaplasma spp. 16S rRNA CAAGCTTAACACATGCAAGTCGAAC 894 [91]
 Ana2-R CCCTTCCGTTAAGAAGGATCTAATC
 BabNu2-F Babesia spp. 18S GACACAGGGAGGTAGTGACAAG 357 [92]
 BabNu2-R CTAAGAATTTCACCTCTGACAGT
  1. Abbreviations: ospA outer surface protein, ITS2 internal transcribed spacer, gltA bacterial citrate synthase gene, 18S and 16S ribosomal RNA genes, Msp2 surface protein antigen, GroEL chaperonin protein, ssrA transfer-messenger RNA, Kda lipoprotein, IGS intergenic spacer region
  2. aAmplicon size without nucleotides of primers