Skip to main content

Table 1 PCR primers designed for each guide RNA. Three PCR primer sets corresponding to each gRNA were designed based on the A. invadans target gene (GenBank:  XM_008877667) to detect the genomic DNA mutation, caused by CRISPR/Cas9

From: Editing the genome of Aphanomyces invadans using CRISPR/Cas9

  Name Position Expected product size (bp) Sequence (5'- 3')
Primer set 1 AiCr1F 35–54 211 GACTCCGACCTTGACGATGC
AiCr1R 227–246 AAAGAGGAATGAGGCGGAGG
Primer set 2 AiCr2F 884–904 214 CCCACACCATGGGAACGATTG
AiCr2R 1080–1098 TTGAGACGAGCCCCACGAG
Primer set 3 AiCr3R 1572–1591 209 GTTCGGCCGTATTAACGCCA
AiCr3F 1763–1781 CTTGGTACATGGCTGCCCA