Skip to main content

Advertisement

Table 1 Babesia bovis ron2 designed primers

From: Babesia bovis RON2 contains conserved B-cell epitopes that induce an invasion-blocking humoral immune response in immunized cattle

Primer Sequence (5'-3')
Fw0 RON2Bo CACCTCACCGATATGCGTAC
RvI0 RON2Bo GAGTCACTGACACCTTGCC
FwI0 RON2Bo GTCAGTGACTCCCCTCTTCAAG
Rv0 RON2Bo GGAATCACCGCCTAGTAGC
Fw1 RON2Bo GCTACTAGGCGGTGATTCC
RvI1 RON2Bo GCGTCAATAGAGATAAGCAGG
FwI1 RON2Bo CCTGCTTATCTCTATTGACGC
Rv1 RON2Bo CAACCCATTGCTTGATTCCC
Fw2 RON2Bo GGGAATCAAGCAATGGGTTG
RvI2 RON2Bo CTTTCTTAGCAATAGCGTCGG
FwI2 RON2Bo CTTCGTTGCTGGAGGCTACATC
Rv2 RON2Bo CGTTGGATATTCGGTTGAGC
Fw3 RON2Bo GCTCAACCGAATATCCAACG
Rv3 RON2Bo CCGTACTTGATTGCTCTGAG
Fw4 RON2Bo CTCAGAGCAATCAAGTACGG
Rv4 RON2Bo CACGGATGGCTATGACAATG
  1. Note: Eight pairs of primers were designed to get the amplification and sequencing of 4169 bp under the same PCR protocol