Skip to main content

Table 1 Primers used for microfluidic real-time PCR

From: Low genetic diversity of Ehrlichia canis associated with high co-infection rates in Rhipicephalus sanguineus (s.l.)

Species Target gene Forward primer (5'-3') Reverse primer (5'-3') Reference
Babesia spp., Theileria spp., Hepatozoon spp. 18S rRNA GTGAAACTGCGAATGGCTCATTAC; GGCTCATTACAACAGTTATAGTTTATTTG AAGTGATAAGGTTCACAAAACTTCCC; CGGTCCGAATAATTCACCGGAT [66]
Borrelia spp. flaB GCAGTTCARTCAGGTAACGG; GCATCAACTGTRGTTGTAACATTAACAGG GCAATCATAGCCATTGCAGATTGT; ACATATTCAGATGCAGACAGAGGT [67]
Anaplasma spp., Ehrlichia spp. 16S rRNA GAACGAACGCTGGCGGCAAGC; TGCATAGGAATCTACCTAGTAG AGTAYCGRACCAGATAGCCGC; AGTAYCGRACCAGATAGCCGC [68]
Coxiella-like endosymbiont 16S rRNA CGTAGGAATCTACCTTRTAGWGG; TGAGAACTAGCTGTTGGRRAGT ACTYYCCAACAGCTAGTTCTCA; GCCTACCCGCTTCTGGTACAATT [69]
Rickettsia spp. Citrate synthase GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA [70]