Skip to main content

Table 1 Primers used in this study

From: Epidemiology and genetic diversity of Anaplasma ovis in goats in Corsica, France

Target gene Primer/probe (5'-3') Type of PCR Tm (°C)a Fragment length (bp)
msp4 TCATTCGACATGCGTGAGTCA Real-time 60 92
TTTGCTGGCGCACTCACATC 60
FAM-AGCAGAGAGACCTCGTATGTTAGAGGC-BQ1 70
gltA GCCGACTTTGTTGCCACTGT Qualitative 58.7 760
TCCAACCGCCCTTAGCACAA 59.4
msp4 CCCAGCGTTTCCCTCTGTTA 57.1 497
GAGTCCGTGGTAGAACCCAC 57.3
  1. aMelting temperature