Skip to main content

Table 1 Sequences of PCR primers

From: Downregulation of female doublesex expression by oral-mediated RNA interference reduces number and fitness of Anopheles gambiae adult females

Gene Vector base ID Primer name Primer sequence 5′–3′ Efficiency (%)
Rps7 AGAP010592 S7qf1 AGAACCAGCAGACCACCATC 115.02
S7qr1 GCTGCAAACTTCGGCTATTC
Actin5C AGAP000651 ACT-2f TACAACTCGATCATGAAGTGCGA 110.67
ACT-3r CCCGGGTACATGGTGGTACCGCCGGA
Elongation Factor AGAP005128 EFf1 GGCAAGAGGCATAACGATCAATGCG 112.60
EFr1 GTCCATCTGCGACGCTCCGG
Female doublesex AGAP004050 newDSX-f AGAGGGCGGGGAAATTCTAGT 111.19
newDSX-r GGGCTTGTGGCAGTACGAATA
Female doublesex AGAP004050 dsRNA_dsx-f2 (dsx1586) CAAGCGGTGGTCAACGAATA na
dsRNA_dsx-r3 (dsx1589) GCCCACTCCTTAAACACTACTT
Female doublesex AGAP004050 T7dsRNA_dsx-f2 TAATACGACTCACTATAGGGCAAGCGGTGGTCAACGAATA na
T7dsRNA_dsx-r3 TAATACGACTCACTATAGGGGCCCACTCCTTAAACACTACTT