Skip to main content

Advertisement

Table 1 Primers used for the amplification of the partial BoTRAP2 genes

From: Identification of a novel thrombospondin-related anonymous protein (BoTRAP2) from Babesia orientalis

Primer Primer sequence (5′–3′) Restriction enzyme
BoTRAP2-F ATAATGGACTTCGTGAGTTTGTTGAAG  
BoTRAP2-R TACTGTTCGGACGATATTTATCGTATC  
BoTRAP2-1F GAATTCGTGAGTTTGTTGAAGAACTGACTAAG EcoRI
BoTRAP2-1R CTCGAGAGGACCCAGAAGCTCTACCTTCAAC XhoI