Skip to main content

Advertisement

Table 1 Primers and morpholino used in this study

From: Role of gamma-giardin in ventral disc formation of Giardia lamblia

Name (GiardiaDB ID) Nucleotide sequence (5′–3′)a,b
Transgenic G. lamblia expressing HA-tagged Glγ-giardin
 γ-giardin-NcoI-F (GL50803_17230) CATCCCATGGATGAAGTCATCGTTCTCGACCG
 γ-giardin-HAX3-R (GL50308_17230) GTTACGCGGCCGCTTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTAATCAACCTTCGTCGTCATGATC
Recombinant G. lamblia cyclin B
 3977-F (GL50803_3977) CCCAAGCTTATGCATTAGACGACGAA
 3977-R (GL50803_3977) CCGCTCGAGCTTTGCTTCCTTTGTATT
Real-time PCR
 γ-girdin-RT-F (GL50803_17230) GCATCCGAGAGAAACATAAA
 γ-giardin-RT-R (GL50803_17230) TTAATCAACCTTCGTCGTCA
 Actin-F (GL50803_15113) GTCCGTCATACCATCTGTTC
 Actin-R (GL50803_15113) GTTTCCTCCATACCACACG
Mopholino sequences
 Control CCTCTTACCTCAGTTACAATTTATA
 Anti-Glγ-giardin (GL50803_17230) CAATATAAACGCACATTGCGAAGAG
 Anti-GlMBP (GL50803_16343) GCTGAAAACCATAGCCTCGGACATT
  1. aRestriction enzyme sites are underlined
  2. bMutated bases are indicated as italic letters