Skip to main content

Advertisement

Table 1 Primers for this experiment

From: MicroRNA let-7 regulates the expression of ecdysteroid receptor (ECR) in Hyalomma asiaticum (Acari: Ixodidae) ticks

Name Sequence (5ʹ–3ʹ)
ECR-DP F:CTGYGACATCGACATGTACATG
R:TCACTCYTGGATGTCCCARATCTC
dsECR F:GGATCCTAATACGACTCACTATAGGCATCGTCTATGGGTGGTGGTGTGAG
R:GGATCCTAATACGACTCACTATAGGCGATGGCTGTGAGGAGTGCATATTC
dsNC-1 F:GTAGCAGGTGTGGTTCATCC
R:CTGATGCATTGCCTTCGTCC
dsNC F:GGATCCTAATACGACTCACTATAGGGTAGCAGGTGTGGTTCATCC
R:GGATCCTAATACGACTCACTATAGGCTGATGCATTGCCTTCGTCC
ECR-WT-DLR F:AGCTTTGTTTAAACGCCGAGATTTGGGACATCCAAGAG
R:CTAGTCTAGACAGAAAAGAGGGTTAGATTCGC
RP-NC-DLR F:AGCTTTGTTTAAACGCCGAGATTTGGGACATCCAAGAG
R:CTAGTCTAGACAGAAAAGAGGGTTAGATTCGC
ECR-qPCR F:GTGCCAGTGTAGGCGATTCAG
R:CTGTATGCGCTCCACCTTGC
GSP-ECR-3UTR-F1 F:TGGACCCGTGCAAGGTGGAG
GSP-ECR-3UTR-F2 F:ACAGAGCTGCGCACCTTGG
β-actin F:CGTTCCTGGGTATGGAATCG
R:TCCACGTCGCACTTCATGAT
GAPDH F:CGTGCCGCCTGGAGAAACCTG
R:AGAGTGGGAGTTGCTGTTGAAGTCG
let-7-qPCR F:ACACTCCAGCTGGTGAGGTAGTAGGT
miR-2a-qPCR F:ACACTCCAGCTGGTATCACAGCCAGCTT
miR-8-qPCR F:ACACTCCAGCTGGTAATACTGTCAGGTA
mir-451-qPCR F:ACACTCCAGCTGGAAACCGTTACCATTA
miRNA-URP R:GTCGTATCCAGTGCAGGGTCCGAGGT
ECR-NOTI-1429 F:CCGGAATTCATGCGACGCAAGTGCCA
R:AAATATGCGGCCGCTGCATGAGCAGAAAAGAGGG
  1. Note: R= A/G, W= A/T, Y= T/C