Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for conventional PCR, real-time PCR and taxonomic cross-validation of NGS results

From: Assessment of a metabarcoding approach for the characterisation of vector-borne bacteria in canines from Bangkok, Thailand

Taxon targeted PCR type Primer pair (5′-3′) Gene targeted Product size (bp) Reference
Ehrlichia canis-specific cPCR ECA: AACACATGCAAGTCGAACGGA 16S rRNA 400 [7]
Anaplasma platys-specific cPCR PLATYS-F: GATTTTTGTCGTAGCTTGCTATG 16S rRNA 678 [50]
Mycoplasma spp.-specific cPCR HBT-F: ATACGGCCCATATTCCTACG 16S rRNA 600 [48]
Rickettsia Spotted Fever Group cPCR ompB-F: CGACGTTAACGGTTTCTCATTCT Outer membrane protein B (ompB) 252 [49]
Bartonella spp.-specific cPCR prAPT0257: GCCTTCAAGGAGTTGATTTTGTTGTTGCCAAT Filamenting temperature-sensitive mutant Z (ftsZ) 500 [52]
Filarial worm-specific cPCR DIDR-F1: AGTGCGAATTGCAGACGCATTGAG 5.8S-ITS2-28S 430–660 [53]
Rickettsia Spotted Fever and Typhus Groups qPCR CS-F: TCGCAAATGTTCACGGTACTTT Citrate synthase (gltA) 74 [51]