Skip to main content

Advertisement

Table 1 Primers used for conventional PCR, real-time PCR and taxonomic cross-validation of NGS results

From: Assessment of a metabarcoding approach for the characterisation of vector-borne bacteria in canines from Bangkok, Thailand

Taxon targeted PCR type Primer pair (5′-3′) Gene targeted Product size (bp) Reference
Ehrlichia canis-specific cPCR ECA: AACACATGCAAGTCGAACGGA 16S rRNA 400 [7]
HE3: TATAGGTACCGTCATTATCTTCCCTAT
Anaplasma platys-specific cPCR PLATYS-F: GATTTTTGTCGTAGCTTGCTATG 16S rRNA 678 [50]
EHR16S-R: TAGCACTCATCGTTTACAGC
Mycoplasma spp.-specific cPCR HBT-F: ATACGGCCCATATTCCTACG 16S rRNA 600 [48]
HBT-R: TGCTCCACCACTTGTTCA
Rickettsia Spotted Fever Group cPCR ompB-F: CGACGTTAACGGTTTCTCATTCT Outer membrane protein B (ompB) 252 [49]
ompB-R - ACCGGTTTCTTTGTAGTTTTCGTC
Bartonella spp.-specific cPCR prAPT0257: GCCTTCAAGGAGTTGATTTTGTTGTTGCCAAT Filamenting temperature-sensitive mutant Z (ftsZ) 500 [52]
prAPT0258: ACGACCCATTTCATGCATAACAGAAC
Filarial worm-specific cPCR DIDR-F1: AGTGCGAATTGCAGACGCATTGAG 5.8S-ITS2-28S 430–660 [53]
DIDR-R1: AGCGGGTAATCACGACTGAGTTGA
Rickettsia Spotted Fever and Typhus Groups qPCR CS-F: TCGCAAATGTTCACGGTACTTT Citrate synthase (gltA) 74 [51]
CS-R: TCGTGCATTTCTTTCCATTGTG
CS-P (Probe): 6-FAM-TGCAATAGAAGAACCGTAGG CTGGATG-BHQ-1