Skip to main content

Table 1 Primers and probes used in this study

From: Molecular investigation and phylogeny of species of the Anaplasmataceae infecting animals and ticks in Senegal

Species Target gene Primer and probe Sequence (5′–3′) T (°C) Reference
Anaplasmataceae 23S rRNA TtAna-F TGACAGCGTACCTTTTGCAT 60 [23, 24]
Conventional PCR
Anaplasma spp. 23S rRNA Ana23S-212f GTTGAAAARACTGATGGTATGCA 55 [23, 24]
Ehrlichia spp. groEL Ehr-groEL-F GTTGAAAARACTGATGGTATGCA 50 [22]
  1. Abbreviation: T, annealing temperature; seq., sequencing