Skip to main content

Advertisement

Table 1 Primers and probes used in this study

From: Molecular investigation and phylogeny of species of the Anaplasmataceae infecting animals and ticks in Senegal

Species Target gene Primer and probe Sequence (5′–3′) T (°C) Reference
qPCR
Anaplasmataceae 23S rRNA TtAna-F TGACAGCGTACCTTTTGCAT 60 [23, 24]
TtAna-R GTAACAGGTTCGGTCCTCCA
TtAna-S FAM-GGATTAGACCCGAAACCAAG-TAMRA
Conventional PCR
Anaplasma spp. 23S rRNA Ana23S-212f GTTGAAAARACTGATGGTATGCA 55 [23, 24]
Ana23S-753r TGCAAAAGGTACGCTGTCAC
16S rRNA AENW-16S-F1 GCAGACGGGTGMGTAAYG 50 [73]
AENW-16S-R GTGCCAGCAGCCGCGGTAAT
AENW-16S-F2 (seq.) GTGCCAGCAGCCGCGGTAAT
rpoB Ana-rpoBF GCTGTTCCTAGGCTYTCTTACGCGA 55 [22]
Ana-rpoBR AATCRAGCCAVGAGCCCCTRTAWGG
Ehrlichia spp. groEL Ehr-groEL-F GTTGAAAARACTGATGGTATGCA 50 [22]
Ehr-groEL-R ACACGRTCTTTACGYTCYTTAAC
Ticks 12S rDNA T1B AAACTAGGATTAGATACCCT 51 [21]
T2A AATGAGAGCGACGGGCGATGT
  1. Abbreviation: T, annealing temperature; seq., sequencing