Skip to main content

Advertisement

Table 1 Primers designed and used in this study

From: Hidden biodiversity revealed by integrated morphology and genetic species delimitation of spring dwelling water mite species (Acari, Parasitengona: Hydrachnidia)

Marker Taxon Name Direction Sequence (5′–3′)
cox1 Hydrachnidia LCO_Hydr F CAACAAACCAYAAAGAYATTGG
HCO_Hydr R TGGGTGTCCRAARAATCA
Atractides Atr_F F ACCAYAAAGAYATTGGAAC
Atr_R R AAAATCAGAARATATGTTGA
Lebertia Leb_F F CAAACCAYAAAGAYATTGGAAC
Leb_R R CGAAGAATCAAAATARRTGTTG
Partnunia Part_F F ACACTYTACTTYGCTTTTGG
Part_R R CAAAGAATCAAAATAARTGTTG
Feltria Fe_F F ATATTGGYACTTTATATTTCGG
Fe_R R CGAAGAATCAAAATARATGTTG
Protzia Leb_F F CAAACCAYAAAGAYATTGGAAC
Protz_R R GATGTRTTAAARTTTCGATCTG
Hydrovolzia Hydrov_F F TGGGCWGGAATTTTAGGATC
Hydrov_R R TGTTGAAAGAGGATTGGGTC
Hygrobates Riv_F F CAAACCAYAAAGAYATTGGTAC
HCO_Hydr R TGGGTGTCCRAARAATCA
Wandesia Wand_F F ACCAYAAAGAYATTGGGACC
HCO_Hydr R TGGGTGTCCRAARAATCA
28S Hydrachnidia 28SHy_F F AGTACCGTGAGGGAAAGTTG
28SHy_R R GGCAGGTGAGTTGTTACACA
  1. Abbreviations: F, forward; R, reverse