In silico selection of functionally important proteins from the mialome of Ornithodoros erraticus ticks and assessment of their protective efficacy as vaccine targets

Table 1 Primers and PCR conditions used for amplification of the cDNA fragments encoding the target protein regions

Target protein	Target region (aa)	Primer name	Sequence (5ʹ-3ʹ)	Product size (bp)	Restriction enzymes	Expression vector
OeCHI	Extracellular domain (23–467)	Oe6961_BamH1_F	GGATCCCAGGACGGCGCCGCA	1350	BamH1; Sma1	pGEX-4T-1
OeCHI	Extracellular domain (23–467)	Oe6961_Sma1_	CCCGGGCTAGCACATGCCATTGATGCATTTAT	1350	BamH1; Sma1	pGEX-4T-1
OeTSP1*	Long extracellular domain (107–195)	Oe1520_BamH1_F	GGATCCAAGGTGGCTGACGGAGACA	282	BamH1; Sma1	pGEX-4T-1
OeTSP1*	Long extracellular domain (107–195)	Oe1520_Sma1_R	CCCGGGCTAGACAGCACCCGTTCTCTCC	282	BamH1; Sma1	pGEX-4T-1
OeTSP2	Long extracellular domain (124–213)	Oe8446_BamH1_F	GGATCCGCCTACGTCTCAACGTCCA	285	BamH1; Sma1	pQE-30
OeTSP2	Long extracellular domain (124–213)	Oe8446_Sma1_R	CCCGGGCTATGAGAGTCCATTGGATCGCA	285	BamH1; Sma1	pQE-30
OePK4	Truncated, without signal P (22–109)	tOe9280_BamH1_F	GGATCC AGGCCTACCGAATCCGAGT	279	BamH1; Sma1	pQE-30
OePK4	Truncated, without signal P (22–109)	Oe9280_Sma1_R	CCCGGGTTACTGGAGAGGGATCTCTAC	279	BamH1; Sma1	pQE-30
OeRPP0	Whole protein (1–319)	OeRPP0_BamH1_F	GGATCCATGGTCAGGGAGGATAAGACA	972	BamH1; Hind3	pQE-30
OeRPP0	Whole protein (1–319)	OeRPP0_Hind3_R	AAGCTTCTAATCAAAAAGTCCGAAGCCCA	972	BamH1; Hind3	pQE-30

Notes: Primers include suitable restriction sites (underlined) to assist in the sub-cloning into the corresponding expression vector (last column)
PCR conditions were the same for all targets (94 °C 3 min; 10 × (94 °C for 15 s 59.5 °C for 30 s, 72 °C for 40 s) + 25 × (94 °C for 15 s, 66 °C for 30 s; 72 °C for 40 s); 72 °C for 7 min), except for TSP1, which required 60.5 °C in the first 10 amplification rounds

ISSN: 1756-3305