Skip to main content

Advertisement

Table 1 Primers and PCR conditions used for amplification of the cDNA fragments encoding the target protein regions

From: In silico selection of functionally important proteins from the mialome of Ornithodoros erraticus ticks and assessment of their protective efficacy as vaccine targets

Target protein Target region (aa) Primer name Sequence (5ʹ-3ʹ) Product size (bp) Restriction enzymes Expression vector
OeCHI Extracellular domain (23–467) Oe6961_BamH1_F GGATCCCAGGACGGCGCCGCA 1350 BamH1; Sma1 pGEX-4T-1
Oe6961_Sma1_ CCCGGGCTAGCACATGCCATTGATGCATTTAT
OeTSP1* Long extracellular domain (107–195) Oe1520_BamH1_F GGATCCAAGGTGGCTGACGGAGACA 282 BamH1; Sma1 pGEX-4T-1
Oe1520_Sma1_R CCCGGGCTAGACAGCACCCGTTCTCTCC
OeTSP2 Long extracellular domain (124–213) Oe8446_BamH1_F GGATCCGCCTACGTCTCAACGTCCA 285 BamH1; Sma1 pQE-30
Oe8446_Sma1_R CCCGGGCTATGAGAGTCCATTGGATCGCA
OePK4 Truncated, without signal P (22–109) tOe9280_BamH1_F GGATCC AGGCCTACCGAATCCGAGT 279 BamH1; Sma1 pQE-30
Oe9280_Sma1_R CCCGGGTTACTGGAGAGGGATCTCTAC
OeRPP0 Whole protein (1–319) OeRPP0_BamH1_F GGATCCATGGTCAGGGAGGATAAGACA 972 BamH1; Hind3 pQE-30
OeRPP0_Hind3_R AAGCTTCTAATCAAAAAGTCCGAAGCCCA
  1. Notes: Primers include suitable restriction sites (underlined) to assist in the sub-cloning into the corresponding expression vector (last column)
  2. PCR conditions were the same for all targets (94 °C 3 min; 10 × (94 °C for 15 s 59.5 °C for 30 s, 72 °C for 40 s) + 25 × (94 °C for 15 s, 66 °C for 30 s; 72 °C for 40 s); 72 °C for 7 min), except for TSP1, which required 60.5 °C in the first 10 amplification rounds