Skip to main content

Advertisement

Table 6 Design of primers used for qPCR analysis

From: Transcriptomic analysis of reproductive damage in the epididymis of male Kunming mice induced by chronic infection of Toxoplasma gondii PRU strain

Gene IDGeneForward primerReverse primerProduct length (bp)
57746piwil2GGCAGAGGCCTTGTGTTTAGCGTTTTGAAGGAGGCCGGAA134
73472Spata18TTATCACGTGTGGCCTGCTCTTAAGCTCCTGCTACGGCAC125
22035Tnfsf10ACGCTTCCAAGATGGTCTCAACAGTCCGTACTCGGCATCT147
21822Tgtp1CGCCACGTCTTCTCACTGTCCACCAAGTGGAATGGTGGCT130
60440Iigp1TCACTATGACTTCCCCGTCCTTGCTTCAGAAATTGCCGCTT132
18663Pgk2GCCTGTGCCAACCCAGATAAACAGTGATGCTTGGAAGGCT145
319555Nwd1CTCTTTGGACCACCAGGCATAGGCTCAGCTTTGATGTCCC125
69982Spink2GCATGCCCTAGGAACCTCAAATATGGCTACCGTCCTCCCT101
11461β-actinAGAGAAGCTGTGCTATGTTGCTGGAACCGCTCGTTGCCAATA128