Skip to main content

Table 6 Design of primers used for qPCR analysis

From: Transcriptomic analysis of reproductive damage in the epididymis of male Kunming mice induced by chronic infection of Toxoplasma gondii PRU strain

Gene ID Gene Forward primer Reverse primer Product length (bp)
57746 piwil2 GGCAGAGGCCTTGTGTTTAG CGTTTTGAAGGAGGCCGGAA 134
73472 Spata18 TTATCACGTGTGGCCTGCTC TTAAGCTCCTGCTACGGCAC 125
22035 Tnfsf10 ACGCTTCCAAGATGGTCTCA ACAGTCCGTACTCGGCATCT 147
21822 Tgtp1 CGCCACGTCTTCTCACTGTC CACCAAGTGGAATGGTGGCT 130
60440 Iigp1 TCACTATGACTTCCCCGTCCT TGCTTCAGAAATTGCCGCTT 132
18663 Pgk2 GCCTGTGCCAACCCAGATAA ACAGTGATGCTTGGAAGGCT 145
319555 Nwd1 CTCTTTGGACCACCAGGCAT AGGCTCAGCTTTGATGTCCC 125
69982 Spink2 GCATGCCCTAGGAACCTCAA ATATGGCTACCGTCCTCCCT 101
11461 β-actin AGAGAAGCTGTGCTATGTTGCT GGAACCGCTCGTTGCCAATA 128