Skip to main content

Table 1 Sequences of the qRT-PCR primers

From: Thioredoxin peroxidase secreted by Echinococcus granulosus (sensu stricto) promotes the alternative activation of macrophages via PI3K/AKT/mTOR pathway

GeneGenBank IDForward primerReverse primer
iNOSNM_010927.3TTCACCCAGTTGTGCATCGACCTATCCATGGTCACCTCCAACACAAGA
TNF-αNM_013693.3AAGCCTGTAGCCCACGTCGTAAGGTACAACCCATCGGCTGG
IL-10NM_010548.2GCCAGAGCCACATGCTCCTAGATAAGGCTTGGCAACCCAAGTAA
Ym1NM_009892.3TCTCTACTCCTCAGAACCGTCAGAGATGTTTGTCCTTAGGAGGGCTTC
Fizz1NM_181596.4TACTTGCAACTGCCTGTGCTTACTTATCAAAGCTGGGTTCTCCACCTC
Arg1NM_007482.3CTCCAAGCCAAAGTCCTTAGAGAGGAGCTGTCATTAGGGACATC
GAPDHNM_001289726.1CATGGCCTTCCGTGTTCCTACCTGCTTCACCACCTTCTTGAT