Skip to main content

Table 2 Sequences of primers used for expressed cytokines detection

From: Sirolimus enhances the protection achieved by a DNA vaccine against Leishmania infantum

Gene Primer sequence (5ʹ-3ʹ)
RPL18 F GTCCCTGTCCCGGATGATC
R GACAGTCCCCACAACCACG
IFN-γ F CTATGTCTGGCTGCTACTGCCA
R TTCACGACATCTAAGCTACTTGAGTTAA
TNF-α F CCAGACACTCACACTCAGATCATCTT
R CACTTGGTGGTTTGCTACAACGT
TGF-β F CTACCACGCCAACTTCTGTCTG
R TGTAGAGGGCAAGGACCTTACTG
FoxP3 F CAAGTGGCCTGGTTGTGAGA
R TGATCTGCTTGGCAGTGCT’
IL-21 F CCAGCTCCACAAGATGTAAAGGA
R GCTGACTTGAGTTTGGCCTTCT
IL-10 F CATCGATTTCTCCCCTGTGAA
R GACGCCTTTCTCTTGGAGCTT
NOS2 F CCAGAACAGAGGGCTCAAAGG
R CCTGCATCTCTTCCCGATAGAG
  1. Note: Data extracted and modified from Espitia et al. [37] and Zivcec et al. [36]
  2. Abbreviations: F, forward primer; R, reverse primer