Detection of DNA of filariae closely related to Mansonella perstans in faecal samples from wild non-human primates from Cameroon and Gabon

Table 1 Primers and PCR programs

Target organism	Gene	Primer name	Sequence (5′–3′)	Product size (bp)	Thermal profile*
					Step 1		Step 2		Step3		N
					T	D	T	D	T	D
Filariae	12S rDNA	12SdegF2/	ATTACYTATTYTTAGTTTA	~ 600	94	30	45	30	68	45	45^b
		12SnemR2^a	CTACCATACTACAACTTACGC	~ 600	94	30	45	30	68	45	45^b
		12SF/	GTTCCAGAATAATCGGCTA	~ 450	94	30	54	30	68	30	35
		12SdegR	ATTGACGGATGRTTTGTACC	~ 450	94	30	54	30	68	30	35
	cox1	FCo1extdF1	TATAATTCTGTTYTDACTA	~ 970	94	30	45	30	68	60	45^b
		FCo1extdR1^a	ATGAAAATGAGCYACWACATAA	~ 970	94	30	45	30	68	60	45^b
		COIintF/	TGATTGGTGGTTTTGGTAA	~ 650	94	30	54	30	68	45	35
		COIintR	ATAAGTACGAGTATCAATATC	~ 650	94	30	54	30	68	45	35
Hook/ Nodular worms	ITS2	NC1	ACGTCTGGTTCAGGGTTGTT	~ 900	94	30	50	30	72	45	45
		NC2	TTAGTTTCTTTTCCTCCGCT	~ 900	94	30	50	30	72	45	45
		OesophITS2	TGTRACACTGTTTGTCGAAC	250–300	94	30	55	30	72	30	35
		NC2	TTAGTTTCTTTTCCTCCGCT	250–300	94	30	55	30	72	30	35

^aITS2 PCRs start with 95 °C for 15 min and finish by 72 °C for 10 min; 12S rDNA and cox1 PCRs start with 94 °C for 3 min and finish with 68 °C for 10 min
^b35× for DBS and 45× for stool samples
Abbreviations: Step 1, denaturation; Step 2, annealing; Step 3, elongation; T, temperature (°C); D, duration (s); N, number of cycles

ISSN: 1756-3305