Skip to main content

Table 1 The sequences of B. motasi CPA-VF primers and probes

From: Rapid detection of Babesia motasi responsible for human babesiosis by cross-priming amplification combined with a vertical flow

  Primer name Sequence (5′-3′)
Set one BLT-5 s GCTAATTGTAGGGCTAATACAAG
BLT-2 s FITC-CGATGCCTTTTGGCGGCG
BLT-3 s Biotin-GCTTTTAAACCAATTGTTGG
BLT-2s1a CGATGCCTTTTGGCGGCGCGATTCGCAAGTTTATTATG
BLT-4a CTTGAATGGAACATCGCTAA
Set two BLT-5 s GGADWWDGTCCGKTTTTG
BLT-2 s FITC-CTTAGAGGGACTCCTGC
BLT-3 s Biotin-GCTTGAAGCGTGGGGT
BLT-2s1a CTTAGAGGGACTCCTGCCAGACCTGTTATTGCCTT
BLT-4a CGCCTGCCGTTCGACGATT