Coronavirus in cat flea: findings and questions regarding COVID-19

Parasites & Vectors

Table 1 RT-PCR targets, oligonucleotide primers and results

RT-PCR target	Primers: 5′–3′ sequences (amplicon size)	Results (flea sample: Ct)
Coronavirus generic group ORF1b	11-FW: TGATGATGSNGTTGTNTGYTAYAA 13-RV: GCATWGTRTGYTGNGARCARAATTC (179 bp)	Fed: na Unfed: 35.24 Feral cat 1: 36.16 Feral cat 2: na
SARS-CoV-2, RdRp-IP2	nCoV_IP2-12669Fw: ATGAGCTTAGTCCTGTTG nCoV_IP2-12759Rv: CTCCCTTTGTTGTGTTGT nCoV_IP2-12696b: AGATGTCTTGTGCTGCCGGTA [5′]Hex [3′]BHQ-1 (108 bp)	Fed: na Unfed: na Feral cat 1: na Feral cat 2: na
SARS-CoV-2, RdRp-IP4	nCoV_IP4-14059Fw: GGTAACTGGTATGATTTCG nCoV_IP4-14146Rv: CTGGTCAAGGTTAATATAGG nCoV_IP4-14084: TCATACAAACCACGCCAGG [5′]Fam [3′]BHQ-1 (107 bp)	Fed: na Unfed: na Feral cat 1: na Feral cat 2: na
SARS-CoV-2, E-gene	E_Sarbeco_F1: ACAGGTACGTTAATAGTTAATAGCGT E_Sarbeco_R2: ATATTGCAGCAGTACGCACACA E_Sarbeco_P1: ACACTAGCCATCCTTACTGCGCTTCG [5′]Fam [3′]BHQ-1 (125 bp)	Fed: na Unfed: na Feral cat 1: na Feral cat 2: na

Notes: RNA samples were extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Valencia, CA, USA) from midguts dissected from laboratory-reared unfed and fed cat fleas [3] and from the pools of fleas collected from feral cats. A SYBR green One-Step real-time RT-PCR assay (BioRad, Hercules, CA, USA) targeting the ORF1b was used for generic detection of coronaviruses [16]. Three SARS-CoV-2-specific RT-PCRs targeting the envelop protein E-coding gene and two targets (IP2 and IP4) of RNA-dependent RNA polymerase gene (RdRp) were conducted using the SuperScript III Platinum One-Step qRT-PCR kit (Thermo Fisher Scientific). The protocols used for RT-PCR are included in the WHO guidelines (https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance). The positive controls included a positive sample loaned from the University Hospital of Ciudad Real, Spain and an in vitro transcribed RNA derived from the strain BetaCoV_Wuhan_WIV04_2019 (EPI_ISL_402124) loaned by the Pasteur Institute, Paris, France. Real-time RT-PCR was carried out using the CFX96 Touch Real-Time PCR Detection System Thermal Cycler (BioRad, Hercules, CA, USA). Flea samples: Fed and Unfed, laboratory-reared cat flea; Feral cat, pool of feral cat fleas
Abbreviations: na, not amplified; Ct, cycle threshold

ISSN: 1756-3305