Skip to main content

Table 2 Primers and target genes used for pathogen detection in cats across Italy

From: A molecular survey of vector-borne pathogens and haemoplasmas in owned cats across Italy

PathogensPrimer sequence (5′–3′)Target geneAmplicon size (bp)References
HaemoplasmasaMycf: AGCAATRCCATGTGAACGATGAA16S rRNA127[31]
aMycr1: TGGCACATAGTTTGCTGTCACTT
HaemoplasmasbMycE929f: ACGGGGACCTGAACAAGTGGTG16S rRNA259[26]
bMycE1182r: AGGCATAAGGGGCATGATGACTTG
Mycoplasma haemofelis/M. haemocanisbRNasePF1: CTGCGATGGTCGTAATGTTGRNaseP166[33]
bRNasePR1: GAGGAGTTTACCGCGTTTCA
Bartonella henselae/B. clarridgeiaeBART-LC-GEN-F: ATGGGTTTTGGTCATCGAGTCitrate synthase190[32]
BART-LC-HEN-R: AAATCGACATTAGGGTAAAGTTTTT
BART-LC-CLA-R: CAAGAAGTGGATCATCTTGG
Ehrlichia spp./Anaplasma spp.EHR16SD: GGTACCYACAGAAGAAGTCC16S rRNA345[29]
EHR16SR: TAGCACTCATCGTTTACAGC
Babesia spp./Hepatozoon spp.RLBF: GAGGTAGTGACAAGAAATAACAATA18S rRNA460[28]
RLBR: biotin-TCTTCGATCCCCTAACTTTC
FilarioidsNTF: TGATTGGTGGTTTTGGTAAcox1660[30]
NTR: ATAAGTACGAGTATCAATATC
  1. aPrimers used in real-time PCR for haemoplasma detection and differentiation
  2. bPrimers used in conventional PCR for haemoplasma detection and differentiation