Skip to main content

Advertisement

Table 1 Primer sequences used for PCR amplification of C. cayetanensis complete mitochondrial genome

From: Molecular typing of Cyclospora cayetanensis in produce and clinical samples using targeted enrichment of complete mitochondrial genomes and next-generation sequencing

PrimerSequence (5′–3′)
1F (2F-begin2)ATGTTTTTAATGTCTCAAGTGAGATCTCAT
1R (Fragment 1-R-2)GGTTTGCAGCAGTTAGAATACTAGAATTAG
2F (Fragment 2-F-1)GTTGGAGCTCAATTACCTCAAGAAGTATTC
2R (3Rb)TTTGTATGGATTTCACGGTCAACTC
3F (F3-Frag3-of-4)GTAACTCCGCTCTAGATGTTGCTTTACACG
3R (R2-Frag3-of-4)CCTCAGTTGGACTTACTAGGGTGGAGTCTG
4F (Fragment1-F-4)GGTTTCATCAATTTGTTTAGGTGTTATTAG
4R (End6R)CACATGATGCT CAGTAGCATGTAGG