Skip to main content

Table 1 Primers and probes used in the one-step RT-qPCR assay

From: One-step RT-qPCR assay for ZIKV RNA detection in Aedes aegypti samples: a protocol to study infection and gene expression during ZIKV infection

Primer/probeGene productSequence (5′-3′)Nucleotide positionAmplicon size (bp)Reference
Zika virus
 NS5-2362FNS5GACTGGGTTCCAACTGGGAG2362–238196*
 NS5-2457RNS5CCACACTCTGTTCCACACCA2438–2457  
 ZIKV 1086EnvCCGCTGCCCAACACAAG1086–110276[15]
 ZIKV 1162cEnvCCACTAACGTTCTTTTGCAGACAT1139–1162  
 ZIKV 1107-FAMEnvAGCCTACCTTGACAAGCAGTCAGACACTCAA1107–1137  
 ZIKV 1086-T71TAATACGACTCACTATAGGGAGACCGCTGCCCAACACAAG*
 NS5-2362-T7 F1TAATACGACTCACTATAGGGAGAGACTGGGTTCCAACTGGGAG*
Aedes aegypti
 DefA-FDefensin AAACTGCCGGAGGAAACCTAT122–141116[62]
 DefA-RDefensin AAATGCAATGAGCAGCACAAG218–237  
 ActF2ActinGAACACCCAGTCCTGCTGACA583–60365[31]
 ActR2ActinTGCGTCATCTTCTCACGGTTAG626–647  
 Act-FAMActinAGGCCCCGCTCAACCCGAAG605–624  
  1. *Designed for the present study
  2. 1Primers containing T7 promoter sequence
  3. 2Primers used in both qRT-PCR methods (TaqMan and Sybr Green)