Skip to main content

Advertisement

Table 1 Primers used in the quantitative RT-PCR in the present study

From: Oncomelania hupensis retains its ability to transmit Schistosoma japonicum 13 years after migration from permissive to non-permissive areas

GeneSequence (5′–3′)Primer length (mer)Tm (°C)GC %Product length (bp)
PSMD4CCTCACCAACAATTTCCACATCT2355.5043.50129
GATCACTTATAGCCTTGCGAACAT2455.8041.70
EWB00_005036ATACAGAAGCAAGTCCTGAA2051.3040.00149
CTCGCCTAATCCATCTTGT1953.0147.37
EWB00_010161CTGTATCATAGTCGTCGTATC2153.6642.86104
GCATCGTTCCTGTTCCTA1852.6250.00
EWB00_002418TTATACGGTGGAAGCGAAT1950.8542.11114
GGTGGGATATTAGGAGTTCAT2153.6642.86
EWB00_003584TGCTATCGGACTCGTGTA1849.8050.00122
GTAGAGACCATGTATGACAGT2150.1042.90
EWB00_003582GCATTGAATACAGCAGGAC1949.7047.40136
TTATAGCAACGGTTCGGTAT2050.0040.00
EWB00_008342CAATCATCCACTTCAAGATACG2253.9540.91147
CCAGCGAAGCAGGAGTAT1854.9055.56
EWB00_005617GTGGTTCGCTACTGTCAT1852.6250.00145
GATACTCACCGCAACTACA1953.0147.37
EWB00_005592CTTATGCGTCGTGGATGA1852.6250.00102
CCAGGATGACCAGAATGAA1953.0147.37
EWB00_010449TCAATGTTGTCCTGAATGTG2051.3040.00100
TTGTCTTGGTGTTCTTGGT1950.8542.11
EWB00_011245CTGTCACACTACAACAAGAAG2153.6642.86126
GTATTTCGTCACTGCCTTTG2053.3545.00
EWB00_009712GTAATGAACCTACTACTGTTGG2253.9540.91106
GTTCGAGCCTCCTGATTG1854.9055.56
EWB00_006199CAGTTGGAGAGCAAGGAG1854.9055.56107
TGATGGACAGGAAGGAATAC2053.3545.00
EWB00_000274GCAACTTCAAGAACCATACA2051.3040.00120
ATTCCACTACGACCATCTC1953.0147.37
EWB00_006201CCTGGTGAATCTGGACTTG1955.1652.63139
CGCCTCTATCTCCTTCTAATC2155.6147.62
  1. Abbreviation: Tm, melting temperature