Skip to main content

Table 1 Molecular detection of tick-borne pathogens: target genes, primer nucleotide sequences, amplicon size

From: Ticks infesting humans and associated pathogens: a cross-sectional study in a 3-year period (2017–2019) in northwest Italy

Species Target gene Nucleotide sequence (5′–3′) Amplicon size (bp) Reference
Rickettsia spp. ompB GTAACCCGGAAGTAATCGTTTCGTAA (forward)
GCTTTATAACCAGCTAAACCACC (reverse)
511 [7]
Borrelia burgdorferi (s.l.) Flagellin AGAGCAACTTACAGACGAAATTAAT(forward)
CAAGTCTATTTTGGAAAGCACCTAA (reverse)
482 [36]
Anaplasma phagocytophilum msp2 CCAGCGTTTAGCAAGATAAGAG (forward)
GMCCAGTAACAACATCATAAGC (reverse)
334 [22]