Skip to main content

Table 1 qRT-PCR primer sequences

From: Transcriptomic profiling of three-dimensional cholangiocyte spheroids long term exposed to repetitive Clonorchis sinensis excretory-secretory products

Gene Primer sequences (5′ to 3′) Accession number
XAF1 F: CTCGGTGTGCAGGAACTGTA NM_001353135.1
R: CAGTGCTCCTCCATGGTTTC
TRIM22 F: CTGTGCCTCCCTGTCGTATT NM_006074.5
R: TCATGGGGACTAGGCAGTTC
CXCL10 F: CTGTACGCTGTACCTGCATCA NM_001565.4
R: CTTGATGGCCTTCGATTCTG
BST2 F: CACTGTGATGGCCCTAATGG NM_004335.4
R: CTTCTCAGTCGCTCCACCTC