Skip to main content

Table 1 siRNA target sequences, corresponding genes, and resulting male:female sex ratios following treatments

From: A conserved female-specific larval requirement for MtnB function facilitates sex separation in multiple species of disease vector mosquitoes

siRNA Target sequence Corresponding genes Species siRNA soaking treatment
Males: Females (n)
Male mortality
P value
Female mortality
P value
496 GAACAUGCUAUGAAAGAAUAUCCUG AAEL011830 A. aegypti 23:12 (40) 1.0000 0.0033
529 GCAUCAAGCUUGAUGAUGAAAUUUA GAPW01003631.1,
Aa-53178 mRNA
A. albopictus 10:4 (20) 1.0000 0.0108
523 CGUGGAUGCAUGAUAAUCGAAUAGU AGAP000470 A. gambiae 28:12 (40) 1.0000 0.0033
534 AGAAUAUCGAUGGAGAUGAUCUGCA CPIJ011357 C. quinquefasciatus 25:7 (40) 1.0000 0.0001
  1. siRNAs and corresponding target sequences/genes in the indicated species, and the altered male:female ratios resulting from siRNA soaking treatments are indicated (P values correspond to Fisher’s exact tests)